Nguyen, Na, and Kim: Stewartia pseudocamellia and Torilis japonica Extracts Inhibit RANKL-induced Osteoclastogenesis in RAW 264.7 Cells

INTRODUCTION▼

Osteoporosis (OP) is characterized by a decrease in Bone Mineral Density (BMD) and bone mass decrease.¹ This results in an increased chance of fractures. Osteoporosis-related bone fractures are prevalent in post-menopausal women because of the reduced estrogen secretion.² Osteoporosis can occur in all age groups and the risk of getting one increases with age. Changes in bone conditions will not be visible most of the time. So, until there is a fracture, the person does not know whether they have osteoporosis. Among races, Asian women and non-Hispanic white are more prone to the disease. African American and Hispanic women have a lower risk of developing osteoporosis.³ The current treatment methods, such as estrogen treatment and Bisphosphonate intake, have been shown to have serious health effects if continued for a long term.^4,5 Also, long-term estrogen treatment may increase the risk of cancer development.⁶ So, a need arises for alternative medicines or treatments with fewer side effects and good activity against osteoporosis.

Bone undergoes continuous remodeling throughout our life. New bone tissues continuously replace mature bone tissues. This process has 100% efficiency in children and young, but older men have only 10% efficiency in replacement.⁷ Mature bone cells or osteoclasts are involved in bone resorption. i.e., removing calcium mineral deposits from the bone and releasing them into the blood. This process is synergic with bone formation, so the amount of bone resorbed equals the amount of bone formed. However, this balance is shifted more toward bone resorption than formation as we age.⁸ This means that the mature bone cells keep replicating and lead to increased bone resorption without any new bone deposits, leading to bone weakening and disease. A continuous imbalance like the above will lead to osteoporosis or osteopenia. Bone formation and bone resorption are tightly regulated by osteoblast-osteoclast proliferation.

Osteoclasts are formed from hematopoietic cells (HSCs). Macrophage colony-stimulating factor (M-CSF) and the Receptor for nuclear factor KappaB ligand (RANKL) activate HSCs to differentiate into multinucleated cells, and the multinucleated cells fuse to form mature osteoclasts. Mature osteoclasts secrete acids, proteases (Cathepsin K), and matrix metalloproteinases (MMP9). MMP9 forms tight junctions between the basal membrane and the osteoclasts. The process of formation of osteoclast is termed osteoclastogenesis. Osteoblasts are derived from the precursor mesenchymal pluripotent cells (MSCs). Bone Morphogenetic Protein 2 (BMP2) stimulates the osteoblastogenesis of MSCs, along with RUNX2 and Osterix or Wnt signaling pathways. The role of osteoblast is the opposite of osteoclast. The osteoblast is responsible for calcium deposition and bone remodeling.⁹ The balance between boneresorbing cells, i.e., osteoclast and the bone-forming cell. i.e., osteoblast is crucial for a healthy bone.^10,11 An imbalance in this process would lead to bone deformities and bone-related diseases. This cross-talk between osteoclast and osteoblast is significant for maintaining the bone’s mechanical strength and calcium homeostasis.¹²

In nature, several plants carry bioactive molecules which have good activity in reducing the osteoclasts population, thereby treating the diseases.

In the present study, we have screened 63 extracts for the osteoclastic inhibitory activity in RAW 264.7 cells and toxicity to select a possible drug candidate for its potential treatment effects on osteoporosis disease.

RESULTS▼

Cytotoxicity of Plant Extracts

To find out if the plant extracts have any toxic effects, the cytotoxicity of 63 plant extracts against RAW 264.7 cells using the MTT reagent was tested. As shown in Fig. 1, 5 of them showed severe toxicity (80-50%), 21 of them showed moderate toxicity (50-30%), 34 of them showed less toxicity (30-1%), and 3 of them increased the viability of RAW 264.7 cells, compared to the DMSO treated control at 100 µg/ml of a plant extract.

Figure1.

Cytotoxicity of plant extracts in RAW 264.7 cells. 1×10⁴ RAW 264.7 cells/well in a 96-well were treated with 100 µg/ml plant extracts. MTT assay was performed 24 h after the plant extracts treatment. Absorbance was measured at 570 nm. All 63 plant extracts were tested simultaneously for this experiment, and the experiments were repeated thrice. DMSO was used for vehicle control. *p < 0.05, **p < 0.01 compared with the control.

Effects of Plant Extracts on Osteoclast Differentiation

In order to test whether 63 plant extracts inhibit osteoclastogenesis, RAW 264.7 were stimulated with 100 ng/ml RANKL with or without 100 µg/ml of plant extracts. As shown in Fig. 2a, osteoclast-like morphological changes in which many cells aggregated and bundled were observed in the RANKL treatment only. This suggested that RANKL-stimulated RAW 246.7 cells were completely differentiated into osteoclast. However, among the 63 plants tested, extracts of Cudrania tricuspidata (P371), Ulmus davidiana var. japonica (P401), Torilis japonica (P411), Stewartia pseudocamellia extracts I and II (P370 and P397), and Cuscuta chinensis (P418) decreased the osteoclast area by more than 40% when compared to the control. Among these 6 candidates, T. japonica extract (P411) showed highest inhibition against the osteoclasts (68%). The extracts of C. tricuspidata (P371) and U. davidiana var. japonica (P401) showed more than 50% osteoclasts inhibition. C. chinensis (P418) and S. pseudocamellia extracts I and II (P370 and P397) showed moderate osteoclast inhibition (45-40%) (Fig. 2a, b).

Figure2.

Effects of plant extracts on RANKL-stimulated osteoclasts differentiation in RAW 246.7 cells. RAW 246.7 cells were stimulated with 100 ng/ml RANKL with or without 100 µg/ml plant extracts. The osteoclast cell-like morphology was analyzed using an inverted microscope. All the cells were fixed with 10% buffered formalin before imaging osteoclasts. Scale bar 1 millimeter. (a) Representative photographs of the morphological changes are presented, and cells were counted to determine osteoclast numbers. Negative Control: No RANKL treatment; Positive Control: RANKL (100 ng/ml) + 1% DMSO. (b) Percentage of osteoclast inhibited. Values are mean ± SD from three independent experiments. *p < 0.05, **p < 0.01 compared with the positive control, ^##p < 0.01 compared with the negative control.

C. tricuspidata (P371) or mandarin melon berry, or Chinese mulberry, is well known for its medicinal use. Totally 158 flavonoids and 99 xanthones are extracted from this.¹³ It has shown protective effects against Nonalcoholic fatty liver disease,¹⁴ atopic dermatitis,¹⁵ diabetes, and obesity. It is a natural anticancer source and has been proven to cure several cancers, namely skin cancer and hematological, urogenital, digestive, and respiratory-related cancers. The bioactive compounds in the C. tricuspidata (P371) can also inhibit osteosarcoma, glioma, and neuroblastomas. It is already proved that C. tricuspidata fraction or its xanthone, Cudratricusxanthone A (CTXA) and Cudratricusxanthone U (CTXU) can inhibit osteoclast differentiation.^16,17,18

U. davidiana var. japonica (P401) or Japanese elm extracts are a general Korean folk medicine for treating inflammation. Its extracts have been proven to have anti-osteoporotic effects both in vitro and in vivo.^19,20 Kim, Jeonghyun, et al. showed that combining U. davidiana extract and Cornus officinalis extract can inhibit bone loss in ovariectomized mice. Water extracts of U. davidiana suppressed collagen-induced arthritis in mice proving its anti-inflammatory properties.^21,22 It also have MC3-T3 E1 (preosteoblast) proliferation, anti-osteopenic, and differentiation activity.^23,24 Osteopenia is an early stage of osteoporosis. In this case, the bone mineral density will be low, but it will not be as low as the case in osteoporosis. However, U. davidiana inhibited the growth of mouse osteoblasts at a concentration of 10 µg/ml.²⁵

T. japonica (P411), Japanese hedge parsley, is a flowering plant native to Asia, considered an invasive species.²⁶ T. japonica extract can inhibit melanin synthesis.^27,28 It also has anticancer and anti-metastatic properties.^29,30 Moreover, it is one of the components in Hansu-Daebowon, a dog medicine that has been proven to exert anti-osteoporotic effects in both in vitro and in vivo models.³¹

Stewartia koreana or S. pseudocamellia (P370 and P397) have been used as Korean folk medicine since ancient times. It has been used to treat acute gastroenteritis and aches. Recently, it is also proven to be effective in controlling angiogenesis, in the case of cancer,³² inflammation,³³ and helps skin whitening.³¹ It can prevent osteoclast differentiation and bone resorption by reducing the activation of p38 and ERK.³⁴ The major bioactive compounds in S. pseudocamellia include ampelopsin, catechin, fraxin, proanthocyanidin-A2, (2R, 3R)-taxifolin-3-β D-glucopyranoside, and (2S, 3S)-taxifolin-3-β D-glucopyranoside.³⁵

C. chinensis (P418) has been used in traditional medicine in the south and southeast Asia (esp in China and India). Pharmacological studies include anti-aging, antioxidant, antitumor, antipyretic, antihypertensive antiosteoporotic, anti-inflammatory, analgesic, and aphrodisiac properties.³⁶ Its extract contains various phenolic compounds, flavonoids, and alkaloids. Bioactive compounds of Cuscuta sp. includes, amarbelin, bergenin, betasterol, cuscutamine, cuscutin, coumarin, dulcitol, quercetin, luteolin, bergenin, amarbelin, beta-sterol, stigmasterol, and myricetin.³⁷ It also has novel compounds like 7’-(3’,4’-dihydroxyphenyl)-N-[(4-methoxyphenyl)ethyl]propenamide, 7’-(4’-hydroxy,3’-methoxyphenyl)-N-[(4-butylphenyl)ethyl]propenamide, 3’-methoxy-4’, 5,7-trihydroxy flavone-3-glucoside, Swarnalin and Cisswarnelin.³⁸

Plant Extracts Decreased Osteoclast-Related Gene Expression

TRAP is a maker for osteoclasts and has proteolytic role in bone resorption. RANKL is a regulator of osteoclasts maturation and activity. Cathepsin K (CTSK), and MMP-9 are the most abundant proteases in osteoclast. OCSTAMP is required for pre-osteoclast fusion and for optimal bone resorption activity. RUNX2 is a central transcription factor regulating osteoblast differentiation and promoting bone mineralization. TRAP, RANKL, CTSK, OCSTAMP, and MMP9 are known to be predominantly expressed in active osteoclasts. Therefore, to further examine the anti-osteoclastogenic activity of plant extracts, the expression of osteoclast-specific genes (TRAP, RANKL, CTSK, OCSTAMP, and MMP9) were investigated. The mRNA expression of TRAP, RANKL, and CTSK were decreased by treatment of extract of C. tricuspidata (P371), S. pseudocamellia (P397), U. davidiana var. japonica (P401), and T. japonica (P411) in RANKL-stimulated RAW 246.7 cells (Fig. 3a, b, c). C. tricuspidata (P371), S. pseudocamellia (P397), and U. davidiana var. japonica (P401) extracts significantly reduced the expression of MMP9 compared with control (Fig. 3d). C. tricuspidata (P371), and T. japonica (P411) extracts decreased the expression of OCSTAMP compared with control (Fig. 3e). Not only that, C. tricuspidata (P371), U. davidiana var. japonica (P401), and T. japonica (P411) extracts markedly induced osteoblast-related RUNX2 gene expression (Fig. 3f). These results indicate that the plant extracts of C. tricuspidata (P371), S. pseudocamellia (P397), U. davidiana var. japonica (P401), and T. japonica (P411) significantly inhibit the RANKL-induced bone resorting function and osteoclast formation.

Figure3.

RANKL-mediated osteoclastogenesis suppressed by treatment of extract of C. tricuspidata (P371), U. davidiana var. japonica (P401), T. japonica (P411) and S. pseudocamellia (P397). (a-e) Changes in the mRNA expression level of osteoclast-related genes (TRAP, RANKL, CTSK, OCSTAMP, and MMP9) and (f) osteoblast-related gene (RUNX2). RAW 264.7 cells were treated with 100 µg/ml plant extracts 24 h incubation after seeding along with 100 ng/ml RANKL treatment. RANKL treatment was used as a positive control (PC), and the group without RANKL treatment was used as a negative control (NC). Ordinary one-way ANOVA analysis was used to compare the groups with the positive control (PC). *p < 0.001; **p < 0.0001.

DISCUSSION▼

Osteoporosis majorly affects the older population. Osteoporosis is a result of an imbalance in the osteoclastogenesis and osteoblastogenesis processes. There must be a balance between the number of bone cells formed and the number of bone minerals absorbed. If this balance is broken, it will lead to either osteoporosis or osteopetrosis. In either case, the result is a fracture. In older people, these fractures are often life-threatening and can affect the rest of their lives. Osteoporosis results from the dominant increase in osteoclast activity, breaking the balance between osteoblasts and osteoclasts. This results in bone mineral absorption (also called bone resorption), leading to a rise in pores in the bone. Increased porosity would make the bone fragile. The current treatment methods either focus on enhancing bone formation using estrogen treatment/parathyroid hormone treatment or inhibiting bone resorption using calcium/calcitonin supplementation or bisphosphonates treatment.^39,40 There are several bisphosphonates available in the market which are used for the treatment of osteoporosis. However, the long-term usage of bisphosphonates results in adverse side effects, such as the increased risk of bisphosphonate-related bone fractures and the development of osteonecrosis of the jaw.⁴¹ Therefore, there is a need to develop safer and more effective medicines for osteoporosis treatment.

Natural products are a source of multiple metabolites, and blooming technology and metabolomics are increasingly being considered to identify and develop novel therapeutic agents.⁴² So, big and upcoming targets are available for developing new medicines from natural sources, like plants. In this study, we screened 63 plant extracts for their inhibitory potential against osteoclasts generated from RANKL-stimulated RAW 264.7 cells. We checked each plant extract’s cytotoxicity by MTT in RAW 264.7 cells and 26 extracts showed high toxicity, i.e., ≤ 65% cell viability (Fig. 1).

We performed osteoclast differentiation using murine RANKL to stimulate Raw 264.7 cells to determine which plant extract inhibits osteoclasts. Six extracts, namely, C. tricuspidata (P371), U. davidiana var. japonica (P401), T. japonica (P411), S. pseudocamellia extracts I and II (P370 and P397), and C. chinensis (P418) exhibited more than 40% reduction in osteoclast area compared to the control (Fig. 2). Out of which, T. japonica extract exhibited highest inhibition (68%) but with most toxic effects among the six (56% cytotoxic) on RAW 264.7 cells. C. tricuspidate (P371) extract showed both higher osteoclastic inhibition (57% inhibition) and exhibited fewer toxic effects (19% toxic) on RAW 264.7 cells. qRT-PCR was also performed for osteoclast-related genes RANK, TRAP, CTSK, MMP9, OCSTAMP, and osteoblast-related gene RUNX2. Extract of C. tricuspidata (P371), S. pseudocamellia (P397), U. davidiana var. japonica (P401), and T. japonica (P411) suppressed the expression of osteoclast-related genes (Fig. 3a-e). C. tricuspidata (P371), U. davidiana var. japonica (P401), and T. japonica (P411) extracts also increased RUNX2 expression, an osteoblast marker (Fig. 3f). RUNX2 helps the differentiation of preosteoblasts to osteoblasts.⁴³ The above confirms these plant extracts' role in controlling osteoclasts' differentiation and growth.

Some bioactive constituents^6,7 with anti-osteoclastic properties^44-49 include Quercetin, Kaempferol, Hyperoside, Scoparone, and Luteolin. While, T. japonica has Kaempferol, Quercetin, and Luteolin^50,51 as its primary components. S. pseudocamellia extracts I and II (P370 and P397) exerted moderate osteoclast inhibition (44%), have Ampelopsin (Dihydromyricetin),^52,53 Catechin,⁵⁴ taxifolin-3-βD-glucopyranoside,⁵³ as their primary constituents.⁵⁵ All of the components mentioned above possess anti-osteoclastic activity individually. Moreover, the compound proanthocyanidin in S. pseudocamellia has been proven to increase osteoblast activity⁵⁶ and decrease osteoclastogenesis.⁵⁷ In the cytotoxicity experiment, as shown in Fig. 1, extract of S. pseudocamellia increased the proliferation of RAW 264.7 cells by 19%. This indicates that the extract of S. pseudocamellia could be used as a potential candidate for the treatment of osteoporosis.

Kaempferol and astragalin were the main component in C. australis but hyperoside was the main component in C. chinensis.⁵⁸ Astragalin has been proven to regulate osteoclastogenesis⁵⁹ negatively. Kaempferol was the most common bioactive constituent among these six candidates, decreasing osteoclast area. If a plant extract possesses one or more of the following compounds, Kaempferol, Quercetin, Luteolin, Ampelopsin, Catechin or taxifolin-3-β-D-glucopyranoside, plant extract might cause osteoclast inhibition. One similarity among these active compounds is that they all have the same backbone. They all have three benzyl ring structures in common (C₁₅H₁₀O₆).

Hence, the observed osteoclast inhibition might be caused by one of these or the combination of these known compounds. Further experiments are necessary to investigate the unknown component or the mechanism of these known compounds in the inhibition of osteoclasts.

MATERIALS AND METHODS▼

Preparation of Plant Extracts

Dried and powdered part of plant was extracted^60,61 with distilled water and lyophilized as discussed previously.^62-66 The Lifetree company provided all 63 plant extracts. The lyophilized sample was then dissolved in DMSO (Junsei Chemical Co., Ltd, Japan). The stock concentration of sample is 10 mg/ml for the test.

Animal Cell Culture

The Murine macrophage cell line RAW 264.7 (TIB-71) was cultured in Dulbecco’s Modified Eagle’s medium (DMEM) (Welgene, Gyeongsangbuk-do, South Korea) with L glutamine and high glucose. To that, 10% fetal bovine serum (FBS) (Gibco, NY, USA) and 1% penicillin-streptomycin (Gibco, NY, USA) were added to support its proliferation, growth, and survival. For differentiation, the cells were cultured in alpha minimal essential medium (α-MEM) (Welgene, Gyeongsangbuk-do, South Korea) with 100 ng/mL murine s-RANKL (PreproTech, NJ, USA). The cells were grown until three passages before starting the experiment.^67-69

Osteoclast Differentiation and Plant Extract Treatment

The cells were seeded at 1×10⁴ cells per well in a 96-well plate and 5×10⁵ for a 6-well plate. DMEM media with 10% FBS and 1% penicillin-streptomycin was used for the growth and proliferation of RAW 264.7 cells. After 24 h of incubation at 37 ℃ with 5% CO₂, the media was changed to α-MEM and stimulated with 100 ng/ml RANKL with or without 100 µg/ml plant extracts. Negative control: No RANKL treatment; positive control: RANKL (100 ng/ml) + 1% DMSO. The media was changed once, every three days, until mature osteoclast was observed under the microscope.^70,71

Area of Osteoclast and Percentage Inhibition Calculation

After the development of osteoclasts, the media was carefully removed and washed once with 1X PBS. Then the cells were fixed with 10% buffered formalin at room temperature for 15 min.

The area of the exposed region without visible cells or fused mature osteoclasts was measured by tracing the border. ImageJ software was used to calculate the area of osteoclasts. With a polygon selection tool, the exposed region without any observable cells was traced, and the area was calculated and summed for each well after being captured under a light microscope.^72,73 The exposed regions have osteoclasts since the mature osteoclasts are stretched and fused to form a single mass that is not visible to the naked eye. These regions are assumed as osteoclasts.

Percentage inhibition can be calculated as follows,

Area of osteoclast, observed for Test Area of osteoclast, observed for DMSO treatment * 100

Note: Areas <0.5 mm in diameter were all ignored.

Cytotoxicity Assay

RAW 264.7 (TIB-71) cells were cultured in 96 well plates (1×10⁴ cells/well). The cells were treated with plant extracts for 24 h. The old media was replaced with a new media, DMEM with just antibiotics (1% P/S). 10 µl of 5 mg/ml MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Invitrogen, OR, USA) was added to each well of a 96-well plate. Then the plates were covered and incubated at 37 ℃ for 2 h. After incubation, the media was removed, and 100 µl of DMSO was added to each well. The plates were kept on an elliptical shaker for 30 min. Absorbance was measured at 570 nm.⁷⁴ DMSO-alone treated wells were used as negative controls.⁶⁶ Cytotoxicity assay with the 63 extracts was independently repeated thrice.

Quantitative Real-Time PCR (qRT-PCR)

Total RNA was isolated from the fourth day of osteoclast-induced cells using the TRIzol (Ambion life sciences – Invitrogen, USA) method as per company protocol.⁶² The complementary DNA (cDNA) was synthesized from purified RNA using reverse transcriptase (NanoHelix, Daejeon, Republic of Korea) according to the manufacturer’s instructions, osteoclast gene-related⁷⁸ RT-PCR primers were used along with BIOFACT^TM RT-PCR master mix (with QGreen 2X SybrGreen^TM; CellSafe, South Korea) to perform under conditions, 95 ℃ for 7 min, 95 ℃ for 30 sec, 55 ℃ for 30 sec, 72 ℃ for 30 sec, 40 cycles and 95 ℃ for 10 min. GAPDH was used as an endogenous reference control. All samples were diluted 1:4 in DNAse-free water before the qRT-PCR.^63-66 The experiments were independently repeated thrice. The primers used are listed in the Table 1.

Table1.

Osteoclast-specific gene primers

Gene Name	Forward Primer	Reverse Primer	Reference
TRAP	GACGATGGGCGCTGACTTCA	GCGCTTGGAGATCTTAGAGT	77
CTSK	GAAGAAGACTCACCAGAAGCAG	TCCAGGTTATGGGCAGAGATT	78, 79
OCSTAMP	GGCAGCCACGGAACAC	GCAGGGGGTCCCAAAG	80
RANK	TTTGTGGAATTGGGTCAATGA	ACCTCGCTGACCAGTGTGAA	77
RUNX2	CCGCACGACAACCGCACCAT	CGCTCCGGCCCACAAATCTC	81,82
MMP9	GGATGGACTCCTGGCACATGCC	CCTGTGGGCTTGTCACGTGGTG	In this study
GAPDH	GTATCGTGGAAGGACTCATG	GAGGCAGGGATGATGTTC	83

Statistical Analysis

Each result is expressed as the mean ± SEM. Student’s t-test was used within groups using Microsoft Excel software. Using Prism software (version 9.0; GraphPad, CA, USA), one-way ANOVA was performed to compare between groups, with a significance of <0.05, 0.01, 0.001, 0.0001.

CONCLUSION▼

As osteoporosis is a disease that affects almost everyone, mainly in the later part of their life with the increase in their age, new treatment methods must be developed which are safer and more effective than the current treatment methods. We have found six potential candidates from natural plant sources that showed effective inhibitory action against RANKL-stimulated osteoclasts in RAW 264.7 cells. Among them, S. pseudocamellia and T. japonica extracts were highly efficient in controlling osteoclast proliferation. Further studies are required to confirm their activity in vivo systems.

Notes▼

[1] This paper is a part of special issue for [Application of Natural Functional Materials].

[2] Supplementary material Supporting Information. Additional supporting information is available in the online version of this article.

Acknowledgements▼

This research was supported and funded by the GRRC program of Gyeonggi province [GRRC-kyunghee2020(B04)], Republic of Korea.

References▼

T. Sözen L. Özışık N. C. Başaran Eur. J. Rheumatol.2017446 [CrossRef]

M. X. Ji Q. Yu Chronic Dis Transl. Med.201519

S. E. Noel M. P. Santos N. C. Wright J. Bone Miner. Res.2021361881 [CrossRef]

C. L. Gregson D. J. Armstrong J. Bowden C. Cooper J. Edwards N. J. L Gittoes N. Harvey J. Kanis S. Leyland R. Low E. McCloskey K. Moss J. Parker Z. Paskins K. Poole D. M. Reid M. Stone J. Thomson N. Vine J. Compston Arch Osteoporosis20221758 [CrossRef]

K. A. Kennel M. T. Drake Mayo Clin Proc.200984632 [CrossRef]

I. Orzołek J. Sobienraj J. D. Kulawik Cancers202214265 [CrossRef]

E. F. Eriksen L. Mosekilde F. Melsen Bone19867213 [CrossRef]

O. Demontiero C. Vidal G. Duque Ther Adv. Musculoskelet Dis.2012461 [CrossRef]

H. Kito S. Ohya Int. J. Mol. Sci.20212210459 [CrossRef]

10.

J. M. Kim C. Lin Z. Stavre M. B. Greenblatt J. H. Shim Cells202092073 [CrossRef]

11.

B. Riggs S. Khosla L. J. Melton III Endocr Rev.202223279

12.

X. Feng J. M. McDonald Annu Rev Pathol.20116121 [CrossRef]

13.

J. hrestha D. J. Baek Y. S. Oh S. Cho S. H Ki E. Y. Park MoleculesBasel, Switzerland2021262434 [CrossRef]

14.

E. H. Choi E. N. Kim G. S. Jeong Phytomedicine20184386 [CrossRef]

15.

J. Kim N. Cho E. M. Kim K. S. Park Y. W. Kang J. H. Nam M. S. Nam K. K. Kim Appl. Bio. Chem.202063

16.

E. G. Lee H. J. Yun S. I. Lee W. H. Yoo Korean J. Intern. Med.20102593 [CrossRef]

17.

E. N. Kim J. Kwon H. S. Lee S. Lee D. Lee G. S. Jeong Front Pharmacol.2020111048 [CrossRef]

18.

K. W. Kim J. S. Park K. S. Kim U. H. Jin J. K. Kim S. J. Suh C. H. Kim Phytother Res.200822511 [CrossRef]

19.

J. Kim C. G. Lee S. H. Yun S. Hwang H. Jeon E. Park S. Y. Jeong MedicinaBasel202258466

20.

K. S. Kim S. D. Lee K. H. Kim S. Y. Kil K. H. Chung C. H. Kim J. Ethnopharmacol.20059765 [CrossRef]

21.

I. K. Song K. S. Kim S. J. Suh M. S. Kim D. Y. Kwon S. L. Kim C. H. Kim Environ Toxicol Pharmacol.200723102 [CrossRef]

22.

S. J. Suh W. S. Yun K. S. Kim U. H. Jin J. K. Kim M. S. Kim D. Y. Kwon C. H. Kim J. Ethnopharmacol.2007109480 [CrossRef]

23.

G. Karaguzel M. F. Holick Rev. Endocr. Metab. Disord.201011237 [CrossRef]

24.

U. H. Jin S. J. Suh S. D. Park K. S. Kim D. Y. Kwon C. H. Kim Food Chem. Toxicol.2008462135 [CrossRef]

25.

J. M. Baskin C. Carol Bull Tor Bot C.197510267 [CrossRef]

26.

D. H. Song Y. H. Jo J. H. Ahn S. B. Kim C. Y. Yun Y. Kim B. Y. Hwang M. K. Lee J. Nat. Med.201872155 [CrossRef]

27.

C. Y. Yun D. Kim W. H. Lee Y. M. Park S. H. Lee M. Na Y. Jahng B. Y. Hwang M. K. Lee S. B. Han Y. Kim Planta Med.2009751505 [CrossRef]

28.

G. T. Kim S. Y. Kim Y. M. Kim Oncol Rep.2017381206 [CrossRef]

29.

D. H. Kim E. Im D. Y. Lee H. J. Lee D. Y. Sim J. E. Park C. H. Ahn J. L. Koo J. N. Pak S. H. Kim Phytother Res.2022362999 [CrossRef]

30.

S. S. Jang H. S. Ryu C. Y. Jeon G. S. Hwang J. Int. Korean Med.20194058 [CrossRef]

31.

H. J. Roh H. J. Noh C. S. Na C. S. Kim K. H. Kim C. Y. Hong K. R. Lee Biomol TherBasel201523283 [CrossRef]

32.

Z. Zhang L. Zheng Z. Zhao J. Shi X. Wang J. Huang J. Toxicol Sci.201439803 [CrossRef]

33.

T. H. Lee G. W. Lee C. W. Kim M. H. Bang N. I. Baek S. H. Kim D. K. Chung J. Kim Phytother Res.20102420 [CrossRef]

34.

C. K. Park H. J. Kim H. B. Kwak T. H. Lee M. H. Bang C. M. Kim Y. Lee D. K. Chung N. I. Baek J. Kim Z. H. Lee H. H. Kim Int Immunopharmacol.200771507 [CrossRef]

35.

S. I. Lee J. H. Yang D. K. Kim Biomol TherBasel201018191 [CrossRef]

36.

S. Donnapee J. Li X. Yang A. H. Ge P. O. Donkor X. M. Gao Y. X. Chang J. Ethnopharmacol.2014157292 [CrossRef]

37.

S. Patel V. Sharma N. S. Chauhan V. K. Dixit J. Chin. Integr. Med.201210249 [CrossRef]

38.

S. Noureen S. Noreen S. A. Ghumman F. Batool S. N. A. Bukhari Iran J. Basic. Med. Sci.2019221225

39.

E. S. Christenson X. Jiang R. Kagan P. Schnatz Minerva Ginecol.201264181

40.

J. W. Hong W. Nam I. H. Cha S. W. Chung H. S. Choi K. M. Kim K. J. Kim Y. Rhee S. K. Lim Osteoporos Int.201021847 [CrossRef]

41.

K. Shimizu M. Yamanaka M. Gyokusen S. Kaneko M. Tsutsui J. Sato I. Sato M. Sato R. Kondo Phytother Res.200620659 [CrossRef]

42.

X. Yao Z. Li X. Jiang J. Sun G. Ran X. Yang Y. Zhao Y. Yan Z. Chen L. Tian W. Bai Crit Rev. Food Sci. Nutr.202060494 [CrossRef]

43.

T. Komori Adv. Exp. Med. Bio.201065843

44.

S. C. Kwak C. Lee J. Y. Kim H. M. Oh H. S. So M. S. Lee M. C. Rho Biol. Pharm. Bull.201361779

45.

J. W. Lee J. Y. Ahn S. Hasegawa Cytotechnology200961125 [CrossRef]

46.

A. Wattel S. Kamel C. Prouillet J. P. Petit F. Lorget E. Offord M. Brazier J. Cell. Biochem.200492285 [CrossRef]

47.

J. T. Woo H. Nakagawa M. Notoya T. Yonezawa N. Udagawa I. S. Lee I. M. Ohnishi H. Hagiwara K. Nagai Biol. Pharm. Bull.200427504 [CrossRef]

48.

S. H. Lee J. Y. Lee Y. I. Kwon H. D. Jang Int. J. Mol. Sci.201718322 [CrossRef]

49.

G. S. Kim C. R. Park J. E. Kim H. K. Kim B. S. Kim J. Microbiol. Biotechnol.202232220 [CrossRef]

50.

G. Park E. Kim Y. J. Son D. H. Yoon G. H. Sung A. Aravinthan Y. C. Park J. H. Kim J. Y. Cho Pharm Biol.2017552074 [CrossRef]

51.

S. I. Lee J. H. Yang D. K. Kim Biomol TherSeoul2010191

52.

H. T. Huang T. L. Cheng S. Y. Lin C. J. Ho J. Y. Chyu R. S. Yang C. L. Chen, C. H. Shen AntioxidantsBasel, Switzerland202091136 [CrossRef]

53.

T. H. Lee H. B. Kwak H. H. Kim Z. H. Lee Z. D. K. Chung N. I. Baek J. Kim Mol Cells200723398

54.

W. Wang C. Jeong Y. Lee C. Park E. Oh K. H. Park Y. Cho E. Kang J. Lee Y. J. Cho J. H. Y. Park Y. J. Son K. W. Lee H. Kang ACS Omega202274840 [CrossRef]

55.

L. Zhao C. Cai J. Wang L. Zhao W. Li C. Liu H. Guan Y. Zhu J. Xiao Front Pharmacol.20178928 [CrossRef]

56.

S. C. Kwak Y. H. Cheon C. H. Lee H. Y. Jun K. H. Yoon M. S. Lee J. Y. Kim Nutrients2020123164 [CrossRef]

57.

J. P. Bonjour J. Am. Coll. Nutr.201130sup5438S

58.

M. Ye Y. Yan D. A. Guo Rapid Commun Mass Spectrum.2015191469

59.

J. Zhu M. Zhang X. L. Z. G. Yin X. X. Han H. J. Wang Y. Zhou J. Asian. Nat. Prod. Res.2022241157 [CrossRef]

60.

E. E. Elgorashi J. Staden J. Ethnopharmacol.20049027 [CrossRef]

61.

O. A. Aiyegoro A. I. Okoh BMC Complement Altern Med.20101021 [CrossRef]

62.

A. T. Nguyen K. Y. Kim Int. J. Inflam.20208063289

63.

D. Kim K. Y. Kim PLoS One20211610

64.

D. Kim K. Y. Kim Int. J. Mol. Sci.20192212523

65.

M. Kim J. G. Kim K. Y. Kim BiomimeticsBasel20227154 [CrossRef]

66.

Q. W. Zhang L. G. Lin W. C. Ye Chin Med.20181320 [CrossRef]

67.

N. Lampiasi R. Russo I. Kireev O. Strelkova O. Zhironkina F. Zito Biology202110117 [CrossRef]

68.

T. T. Lucy A. N. M. Mamun-Or-Rashid M. Yagi Y. Yonei Int. J. Mol. Sci.2022232371 [CrossRef]

69.

P. C. Osdoby P. Osdoby Methods Mol. Bio.2012816182

70.

S. Marino J. G. Logan D. Mellis M. Capulli Bonekey Rep.201410570

71.

Y. Cheng H. Liu Y. Ma, J. Li C. Song Y. Wang P. Li Y. Chen Z. Zhang PloS one202217

72.

E. B. Choi T. S. Agidigbi I. S. Kang C. Kim Int. J. Mol. Sci.20222313512 [CrossRef]

73.

Z. Chen M. Ding E. Cho J. Seong S. Lee T. H. Lee Front Pharmacol.20211159908

74.

X. Lin D. Bai Z. Wei Y. Zhang Y. Huang H. Deng X. Huang PloS One201914

75.

K. Fujita M. M. Roforth E. J. Atkinson J. M. Peterson M. T. Drake L. K. McCready J. N. Farr D. G. Monroe S. Khosla Osteoporos Int.201425887 [CrossRef]

76.

T. Andrew A. J. Macgregor Curr Osteoporos Rep.2004279 [CrossRef]

77.

Y. Chen X. Wang L. Di G. Fu Y. Chen L. Bai J. Liu X. Feng J. M. McDonald S. Michalek Y. He M. Yu Y. Fu R. Wen H. Wu D. Wang J. Biol. Chem.200828329593 [CrossRef]

78.

B. G. Mi W. Xiong N. Xu H. F. Guan Z. Fang H. Liao Y. Zhang B. Gao X. Xiao J. J. Fu F. Li Sci. Rep.201772328 [CrossRef]

79.

X. Wang T. Liang Y. Zhu J. Qiu X. Qiu C. Lian B. Gao Y. Peng A. Liang H. Zhou X. Yang Z. Liao Y. Li C. Xu P. Su D. Huang Mol. Med.20192543

80.

S. Shanmugarajan Y. Zhang M. Moreno-Villanueva R. Clanton L. H. Rohde G. T. Ramesh J. D. Sibonga H. Wu Int. J. Mol. Sci.2017182443 [CrossRef]

81.

S. Y. Park K. H. Choi J. E. Jun H. Y. Chung J. Kor. Med. Sci.202136e239 [CrossRef]

82.

Y. K. Park S. J. Heo J. Y. Koak G. S. Park T. J. Cho S. K. Kim Int. J. Stem. Cells.201912265 [CrossRef]

83.

P. A. Grange C. Chéreau J. Raingeaud C. Nicco B. Weill N. Dupin F. Batteux PLoS Pathog.200957

Journal Information

Article Information

Stewartia pseudocamellia and Torilis japonica Extracts Inhibit RANKL-induced Osteoclastogenesis in RAW 264.7 Cells

Abstract